View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3516_high_27 (Length: 228)

Name: NF3516_high_27
Description: NF3516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3516_high_27
NF3516_high_27
[»] chr4 (10 HSPs)
chr4 (1-212)||(25251837-25252048)
chr4 (1-212)||(25180994-25181205)
chr4 (9-212)||(25169206-25169409)
chr4 (69-129)||(24999199-24999259)
chr4 (69-129)||(7727743-7727803)
chr4 (69-117)||(25041616-25041664)
chr4 (69-128)||(24987851-24987910)
chr4 (72-137)||(25161083-25161148)
chr4 (69-136)||(25048490-25048557)
chr4 (71-128)||(25193119-25193176)
[»] chr3 (2 HSPs)
chr3 (71-136)||(9212605-9212670)
chr3 (69-129)||(8089432-8089492)
[»] chr6 (3 HSPs)
chr6 (69-129)||(29421030-29421090)
chr6 (90-129)||(29462162-29462201)
chr6 (69-129)||(29405162-29405222)


Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 10)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 25251837 - 25252048
Alignment:
1 taggttcattgaataggaaagattttcctcaaggcttcgtctttggcacagcatcttctgcatatcaatatgaaggtgcagcaagtgaaggtggaagagg 100  Q
    ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25251837 taggttcattgaataggaaagattttcctgaaggcttcatctttggcacagcatcttctgcatatcaatatgaaggtgcagcaagtgaaggtggaagagg 25251936  T
101 accaagtatatgggatacattcactcatagatatcctcaaaaaatcactgatggaaacaatggagacgttgcggttgactcgtatcatcgatataaggaa 200  Q
    | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25251937 agcaagtatatgggatactttcactcatagatatcctcaaaaaatcactgatggaaacaatggagacgttgcggttgactcgtatcatcgatataaggaa 25252036  T
201 gatgttggtatc 212  Q
    ||||||||||||    
25252037 gatgttggtatc 25252048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 25181205 - 25180994
Alignment:
1 taggttcattgaataggaaagattttcctcaaggcttcgtctttggcacagcatcttctgcatatcaatatgaaggtgcagcaagtgaaggtggaagagg 100  Q
    |||||||||| ||||| || ||||| ||  |||||||  | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25181205 taggttcattaaatagaaatgatttcccagaaggctttatatttggcacagcatcttctgcatatcaatatgaaggtgcagcaagtgaaggtggaagagg 25181106  T
101 accaagtatatgggatacattcactcatagatatcctcaaaaaatcactgatggaaacaatggagacgttgcggttgactcgtatcatcgatataaggaa 200  Q
    | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25181105 agcaagtatatgggatactttcactcatagatatcctcaaaaaatcactgatggaaacaatggagacgttgcggttgactcgtatcatcgatataaggaa 25181006  T
201 gatgttggtatc 212  Q
    ||||||||||||    
25181005 gatgttggtatc 25180994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 9 - 212
Target Start/End: Complemental strand, 25169409 - 25169206
Alignment:
9 ttgaataggaaagattttcctcaaggcttcgtctttggcacagcatcttctgcatatcaatatgaaggtgcagcaagtgaaggtggaagaggaccaagta 108  Q
    |||||||| || ||||| ||  |||||||  | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25169409 ttgaatagaaatgatttcccagaaggctttatatttggcacagcatcttctgcatatcaatatgaaggtgcagcaagtgaaggtggaagaggaccaagta 25169310  T
109 tatgggatacattcactcatagatatcctcaaaaaatcactgatggaaacaatggagacgttgcggttgactcgtatcatcgatataaggaagatgttgg 208  Q
    | ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25169309 tttgggatacattcactcatagatatcctcaaaaaatcagtgatggaaacaatggagacgttgcggttgactcgtatcatcgatataaggaagatgttgg 25169210  T
209 tatc 212  Q
    ||||    
25169209 tatc 25169206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 69 - 129
Target Start/End: Original strand, 24999199 - 24999259
Alignment:
69 tatgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcata 129  Q
    ||||||||||||| ||| |||||||||| ||||||||||||||||||||| || |||||||    
24999199 tatgaaggtgcagtaagagaaggtggaaaaggaccaagtatatgggatacctttactcata 24999259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 69 - 129
Target Start/End: Original strand, 7727743 - 7727803
Alignment:
69 tatgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcata 129  Q
    |||||||||||||||  ||||||||| | ||| ||||||||||||||||| ||||||||||    
7727743 tatgaaggtgcagcacatgaaggtggcaaagggccaagtatatgggataccttcactcata 7727803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 69 - 117
Target Start/End: Complemental strand, 25041664 - 25041616
Alignment:
69 tatgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggata 117  Q
    ||||||||||| |||| ||||||||||||||||| ||||||||||||||    
25041664 tatgaaggtgctgcaaatgaaggtggaagaggacaaagtatatgggata 25041616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 69 - 128
Target Start/End: Complemental strand, 24987910 - 24987851
Alignment:
69 tatgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcat 128  Q
    |||||||||||||||  ||||| ||||| |||||||||||| |||||||| |||||||||    
24987910 tatgaaggtgcagcatttgaagatggaaaaggaccaagtatttgggatactttcactcat 24987851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 137
Target Start/End: Complemental strand, 25161148 - 25161083
Alignment:
72 gaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcatagatatcct 137  Q
    |||||||||||||  |||||||| |||  ||||||||||||||| || || |||||||||||||||    
25161148 gaaggtgcagcaacagaaggtggtagaacaccaagtatatgggacacctttactcatagatatcct 25161083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 136
Target Start/End: Complemental strand, 25048557 - 25048490
Alignment:
69 tatgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcatagatatcc 136  Q
    ||||||||||||||||   ||| ||||| |||||||||||| |||||||| ||| |||||| ||||||    
25048557 tatgaaggtgcagcaaaaaaagatggaaaaggaccaagtatttgggatactttcgctcataaatatcc 25048490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 71 - 128
Target Start/End: Complemental strand, 25193176 - 25193119
Alignment:
71 tgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcat 128  Q
    ||||||||||| ||  |||||||| |||||||||||||| ||||| || |||||||||    
25193176 tgaaggtgcagtaaaggaaggtggtagaggaccaagtatctgggacaccttcactcat 25193119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 71 - 136
Target Start/End: Original strand, 9212605 - 9212670
Alignment:
71 tgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcatagatatcc 136  Q
    |||||||||||||| ||||||||| |||  |||||||||||||||||| ||||| |||| ||||||    
9212605 tgaaggtgcagcaaatgaaggtggtagaacaccaagtatatgggatactttcacccataaatatcc 9212670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 129
Target Start/End: Original strand, 8089432 - 8089492
Alignment:
69 tatgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcata 129  Q
    ||||||||||| |||  ||||||||| ||||| ||||| |||||||| || ||||||||||    
8089432 tatgaaggtgctgcatttgaaggtggcagaggtccaagcatatgggacaccttcactcata 8089492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 129
Target Start/End: Original strand, 29421030 - 29421090
Alignment:
69 tatgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcata 129  Q
    |||||||||||||||| |   ||||||| ||||||||||||||||||||| ||||| ||||    
29421030 tatgaaggtgcagcaaatattggtggaaaaggaccaagtatatgggatactttcacgcata 29421090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 90 - 129
Target Start/End: Complemental strand, 29462201 - 29462162
Alignment:
90 ggtggaagaggaccaagtatatgggatacattcactcata 129  Q
    ||||||||||||||||||||||||||||| ||||| ||||    
29462201 ggtggaagaggaccaagtatatgggatactttcacacata 29462162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 129
Target Start/End: Original strand, 29405162 - 29405222
Alignment:
69 tatgaaggtgcagcaagtgaaggtggaagaggaccaagtatatgggatacattcactcata 129  Q
    |||||||||||||||| ||  ||||| ||||||||||| ||||||||| | | ||||||||    
29405162 tatgaaggtgcagcaaatgttggtggcagaggaccaagcatatgggatgcttacactcata 29405222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University