View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3516_low_10 (Length: 334)
Name: NF3516_low_10
Description: NF3516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3516_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 16 - 322
Target Start/End: Complemental strand, 5345385 - 5345079
Alignment:
| Q |
16 |
atcactttacagggtaaagattgccctcgtttataaacatttattcaggtcatctcttaaccgatgtgagacattaacgaaccttgatgtgatgtagcaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5345385 |
atcactttacagggtaaagattgccctcgtttataaacatttattcaggtcatctcttaaccgatgtgaaacattaacgaaccttgatgtgatgtagcaa |
5345286 |
T |
|
| Q |
116 |
ctacacttaatccttggttcataacaagattatgaaaaaggcttctctattataattttgacaacaatgtgaagatttttatggtccttgctgcatcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5345285 |
ctacacttaatccttggttcataacaagattatgaaaaaggcttctctattataattttgacaacaatgtgaagatttttatggtccttgctgcatcata |
5345186 |
T |
|
| Q |
216 |
ttgttacagctgtaattgcagctgtatcatattggattgcaattttctgcaatttcatttgaaaacatagttatgagttgattctaacatcaagcatagt |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5345185 |
ttgttacagctgtaattgcagttgtatcatattggattgcaattttctgcaatttcatttgaaaacatagttatgagttgattctaacatcaagcatagt |
5345086 |
T |
|
| Q |
316 |
cgagact |
322 |
Q |
| |
|
||||||| |
|
|
| T |
5345085 |
cgagact |
5345079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 46 - 90
Target Start/End: Original strand, 33702283 - 33702327
Alignment:
| Q |
46 |
ttataaacatttattcaggtcatctcttaaccgatgtgagacatt |
90 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
33702283 |
ttataaacatttattcatgtcatctctcaaccgatgtgagacatt |
33702327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University