View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3516_low_12 (Length: 310)
Name: NF3516_low_12
Description: NF3516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3516_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 85 - 160
Target Start/End: Complemental strand, 21442358 - 21442283
Alignment:
| Q |
85 |
atgtaatttcactttgcattcgtcacacgatttgtgttttttaaagtaggaggtaggtctcccttgtgtgatcatt |
160 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21442358 |
atgtaatttcactttgcatttgtcacacgatttgtgttttttaaagtaggaggtaggcctcccttgtgtgatcatt |
21442283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 103
Target Start/End: Original strand, 42650597 - 42650659
Alignment:
| Q |
42 |
agtttttgcttgaatctttagtgtatatgtagtaatgaatgaaa--tgtaatttcactttgcat |
103 |
Q |
| |
|
||||||||||||||||| || | | | ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42650597 |
agtttttgcttgaatctctaattt-tgtgtagtaatgaatgaaaaatgtaatttcactttgcat |
42650659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University