View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3516_low_23 (Length: 251)
Name: NF3516_low_23
Description: NF3516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3516_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 122 - 235
Target Start/End: Complemental strand, 1018425 - 1018312
Alignment:
| Q |
122 |
aggaacctatgattaggccttcaactttttagcacttttgaagaaaataaaaaggacagaaagtgcttagtgagggttaatagacgtttcttcaagagga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1018425 |
aggaacctatgattaggccttcaactttttagcacttttgaagaaagtaaaaaggacaaaaagtgcttagtgagggttaatagacgtttcttcaagagga |
1018326 |
T |
|
| Q |
222 |
gtgggggttggaaa |
235 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
1018325 |
gtaggggttggaaa |
1018312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 3 - 106
Target Start/End: Complemental strand, 1018517 - 1018414
Alignment:
| Q |
3 |
cattattgaggtcgcagaaaccgcatttgaccgcaattctacgcaatagaaaggattgcgagacaactacgacaacagtttaaaaccttgttaggaacct |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1018517 |
cattattgaggtcgcagaaaccgcatttgaccgcaattctacgcaatagaaaggattgcgagacaactatgacaacagtttaaaaccttgttaggaacct |
1018418 |
T |
|
| Q |
103 |
atga |
106 |
Q |
| |
|
|||| |
|
|
| T |
1018417 |
atga |
1018414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 24 - 106
Target Start/End: Original strand, 8317372 - 8317454
Alignment:
| Q |
24 |
cgcatttgaccgcaattctacgcaatagaaaggattgcgagacaactacgacaacagtttaaaaccttgttaggaacctatga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8317372 |
cgcatttgaccgcaattctacgcaatagaaaggattgcgagacaactacgacaacagtttaaaaccttgttaggagcctatga |
8317454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 122 - 192
Target Start/End: Original strand, 8317443 - 8317513
Alignment:
| Q |
122 |
aggaacctatgattaggccttcaactttttagcacttttgaagaaaataaaaaggacagaaagtgcttagt |
192 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
8317443 |
aggagcctatgattaggccttcaactttttagcacttttgaagaaaataaaaaggacaaaaagtgtttagt |
8317513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University