View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3518_high_12 (Length: 227)
Name: NF3518_high_12
Description: NF3518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3518_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 10 - 68
Target Start/End: Original strand, 8056764 - 8056822
Alignment:
| Q |
10 |
tcaccttctgctaagagataggcttggattaccttacactagattagatgtgacctaag |
68 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8056764 |
tcaccttctcctaagagataggcttggattaccttacactagaatagatgtgacctaag |
8056822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 17137177 - 17137232
Alignment:
| Q |
10 |
tcaccttctgctaagagataggcttggattaccttacactagattagatgtgacct |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17137177 |
tcaccttctcctaagagataggcttggattaccttacactagaatagatgtgacct |
17137232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 8056880 - 8056927
Alignment:
| Q |
127 |
atgcggttcaggcttctcctggctcttatttgaatttctagctttatc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8056880 |
atgcggttcaggcttctcctggcttttatttgattttctagctttatc |
8056927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 127 - 174
Target Start/End: Original strand, 17137293 - 17137340
Alignment:
| Q |
127 |
atgcggttcaggcttctcctggctcttatttgaatttctagctttatc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
17137293 |
atgcggttcaggcttctcctggcttttatttgattttctagctttatc |
17137340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 127 - 173
Target Start/End: Original strand, 443683 - 443729
Alignment:
| Q |
127 |
atgcggttcaggcttctcctggctcttatttgaatttctagctttat |
173 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
443683 |
atgcggttcaggcttctcctgtcttttatttgaatttatagctttat |
443729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 11 - 65
Target Start/End: Complemental strand, 11562624 - 11562570
Alignment:
| Q |
11 |
caccttctgctaagagataggcttggattaccttacactagattagatgtgacct |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11562624 |
caccttctgttaagagataggcttggattaccttacactagattagatgtgacct |
11562570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 11562508 - 11562461
Alignment:
| Q |
127 |
atgcggttcaggcttctcctggctcttatttgaatttctagctttatc |
174 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||| ||||| |
|
|
| T |
11562508 |
atgcggttcaggcttctcctgacttttatttgaatttctagcgttatc |
11562461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 63
Target Start/End: Original strand, 15103442 - 15103497
Alignment:
| Q |
8 |
tctcaccttctgctaagagataggcttggattaccttacactagattagatgtgac |
63 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| || |||||||||||| |||| |
|
|
| T |
15103442 |
tctcaccttctgttaagagatagacttggattaccatagactagattagatatgac |
15103497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 10 - 65
Target Start/End: Complemental strand, 6936480 - 6936425
Alignment:
| Q |
10 |
tcaccttctgctaagagataggcttggattaccttacactagattagatgtgacct |
65 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6936480 |
tcaccttctcctaagagataggcttggattaccttacactagaatagatgtgacct |
6936425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 174
Target Start/End: Complemental strand, 6936364 - 6936317
Alignment:
| Q |
127 |
atgcggttcaggcttctcctggctcttatttgaatttctagctttatc |
174 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
6936364 |
atgcggttcaggcttctcctgacttttatttgattttctagctttatc |
6936317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 12 - 63
Target Start/End: Complemental strand, 18626388 - 18626337
Alignment:
| Q |
12 |
accttctgctaagagataggcttggattaccttacactagattagatgtgac |
63 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
18626388 |
accttctattaagagataggcttggattaccatacactagattagatatgac |
18626337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 173
Target Start/End: Complemental strand, 18626271 - 18626225
Alignment:
| Q |
127 |
atgcggttcaggcttctcctggctcttatttgaatttctagctttat |
173 |
Q |
| |
|
||||||||||||||||||| | || |||||| ||||||||||||||| |
|
|
| T |
18626271 |
atgcggttcaggcttctccggacttttatttaaatttctagctttat |
18626225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 63
Target Start/End: Original strand, 16310880 - 16310932
Alignment:
| Q |
11 |
caccttctgctaagagataggcttggattaccttacactagattagatgtgac |
63 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| ||||||||| ||||| |||| |
|
|
| T |
16310880 |
cacctcctgttaagagataggcttggattaccatacactagaatagatatgac |
16310932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 63
Target Start/End: Original strand, 18487664 - 18487716
Alignment:
| Q |
11 |
caccttctgctaagagataggcttggattaccttacactagattagatgtgac |
63 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| ||||||||| ||||| |||| |
|
|
| T |
18487664 |
cacctcctgttaagagataggcttggattaccatacactagaatagatatgac |
18487716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 63
Target Start/End: Original strand, 18491874 - 18491926
Alignment:
| Q |
11 |
caccttctgctaagagataggcttggattaccttacactagattagatgtgac |
63 |
Q |
| |
|
||||| ||| |||||||||||||||||||||| ||||||||| ||||| |||| |
|
|
| T |
18491874 |
cacctcctgttaagagataggcttggattaccatacactagaatagatatgac |
18491926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 173
Target Start/End: Original strand, 16310995 - 16311037
Alignment:
| Q |
131 |
ggttcaggcttctcctggctcttatttgaatttctagctttat |
173 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
16310995 |
ggttcaagcttctcctggcttttatttgaatttctagccttat |
16311037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 173
Target Start/End: Original strand, 18487779 - 18487821
Alignment:
| Q |
131 |
ggttcaggcttctcctggctcttatttgaatttctagctttat |
173 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18487779 |
ggttcaagcttctcctggcttttatttgaatttctagccttat |
18487821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 173
Target Start/End: Original strand, 18491989 - 18492031
Alignment:
| Q |
131 |
ggttcaggcttctcctggctcttatttgaatttctagctttat |
173 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18491989 |
ggttcaagcttctcctggcttttatttgaatttctagccttat |
18492031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 174
Target Start/End: Original strand, 23059252 - 23059290
Alignment:
| Q |
136 |
aggcttctcctggctcttatttgaatttctagctttatc |
174 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
23059252 |
aggcttctcctgacttttatttgaatttctagctttatc |
23059290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University