View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3519_low_4 (Length: 238)
Name: NF3519_low_4
Description: NF3519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3519_low_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 38752598 - 38752818
Alignment:
| Q |
18 |
ggaggtgtgcaagaagctttgaaacattacttgcaccaaagaccttatgaatagctgcaaaatgggtagcaccttgttcatggcaaaagtaaggtgcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752598 |
ggaggtgtgcaagaagctttgaaacattacttgcaccaaagaccttatgaatagctgcaaaatgggtagcaccttgttcatggcaaaagtaaggtgcaaa |
38752697 |
T |
 |
| Q |
118 |
aacacaacctctaacacattttctcctcaagaatttgcaggctccacaaggagaaccagaaccagtcatcatggccgtaagaatttttggttgtttctgg |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38752698 |
aatacaacctctaacacattttctcctcaagaatttgcaggctccacaaggagaaccagaaccagtcatcatggccgtaagaatttttggttgtttctgg |
38752797 |
T |
 |
| Q |
218 |
ctctcttgtgctaatcataat |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38752798 |
ctctcttgtgctaatcataat |
38752818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 26 - 178
Target Start/End: Complemental strand, 30904114 - 30903962
Alignment:
| Q |
26 |
gcaagaagctttgaaacattacttgcaccaaagaccttatgaatagctgcaaaatgggtagcaccttgttcatggcaaaagtaaggtgcaaaaacacaac |
125 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| ||||||||||| |||| |||||| ||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
30904114 |
gcaagaagctttgagacattgcttgcaccaaaaaccttatgaatggctgaaaaatgtgtagcaccttgttcatgagaaaaataaggtgcaaaaacacaac |
30904015 |
T |
 |
| Q |
126 |
ctctaacacattttctcctcaagaatttgcaggctccacaaggagaaccagaa |
178 |
Q |
| |
|
|||| | ||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
30904014 |
ctcttatacattttcttctcaaaaatttgcaagctccacaaggagaaccagaa |
30903962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University