View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3520_low_18 (Length: 309)
Name: NF3520_low_18
Description: NF3520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3520_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 169
Target Start/End: Original strand, 2426449 - 2426598
Alignment:
| Q |
19 |
agacctctaggtcatggttcaatgactttaaaatgttcaaaccggggcaaaaaccgcagtcgaactgctcaaataatcgaaccatagacaatgtcggttc |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| ||| ||| |||||| || |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2426449 |
agacctctaggtcatggttcaatggctttaaaacgttcgaactaggg-aaaaactgctgtcgaactgctcaaataatcgaactgtagacaatgtcggttc |
2426547 |
T |
 |
| Q |
119 |
atgattcaaccagttgaagagtctatttgattcgagttttaaaacattgaa |
169 |
Q |
| |
|
|| |||||||| | ||||||||| ||| |||| || |||| |||||||||| |
|
|
| T |
2426548 |
ataattcaaccggatgaagagtcgattcgatttgatttttcaaacattgaa |
2426598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 234 - 296
Target Start/End: Original strand, 2426663 - 2426725
Alignment:
| Q |
234 |
cacttacctaaagcatacatcttttggtaattcaagatatcaaattttctcattctttctctg |
296 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2426663 |
cacttacctaaagcatacatcttttgataattcaagatatcaaattttctcattctttctctg |
2426725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 68 - 136
Target Start/End: Complemental strand, 27291941 - 27291873
Alignment:
| Q |
68 |
aaaaccgcagtcgaactgctcaaataatcgaaccatagacaatgtcggttcatgattcaaccagttgaa |
136 |
Q |
| |
|
||||| |||||||||| ||||||||| ||||| ||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
27291941 |
aaaactgcagtcgaaccactcaaataactgaaccgtagacaatgtcagttcatggttcaaccaattgaa |
27291873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 87 - 136
Target Start/End: Complemental strand, 4536387 - 4536338
Alignment:
| Q |
87 |
tcaaataatcgaaccatagacaatgtcggttcatgattcaaccagttgaa |
136 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
4536387 |
tcaaataaccgaaccatagacaatatcggttcaacattcaactagttgaa |
4536338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 84 - 136
Target Start/End: Original strand, 10479847 - 10479899
Alignment:
| Q |
84 |
tgctcaaataatcgaaccatagacaatgtcggttcatgattcaaccagttgaa |
136 |
Q |
| |
|
|||||||||||| ||||| || ||||| | ||||||| ||||||||||||||| |
|
|
| T |
10479847 |
tgctcaaataattgaaccttaaacaatcttggttcataattcaaccagttgaa |
10479899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University