View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3521_high_10 (Length: 289)
Name: NF3521_high_10
Description: NF3521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3521_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 30242550 - 30242268
Alignment:
| Q |
1 |
tattaacatgtttggtttgttctgtcacaataagaggaataacaaacatgcatttattagggttagaggtttggagatggtgtttaatggcaatggtaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30242550 |
tattaacatgtttggtttgttctgtcacaataagaggaataacaaacatgcatttattagggttagaggtttggagatggtgtttaatggcaatggtaac |
30242451 |
T |
|
| Q |
101 |
atttagtggccgtttgttttcaagttggttagttagtttcaccgttttctttatcgaaagaaacttcatgctaagagaaaaagttttatatttcatctat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30242450 |
atttagtggccgtttgttttcaagttggttagttagtttcaccgttttctttatcgaaagaaacttcatgctaagagaaaaagttttatatttcatctat |
30242351 |
T |
|
| Q |
201 |
ggtttaaggaacagcattcgtaattgtttatggttaggtcttgttttactctcatattggagtgtcgtttttgatgatgtcca |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30242350 |
ggtttaaggaacagcattcgtaattgtttatggttaggtcttgttttactctcatattggagtgtcgttttcgatgatgtcca |
30242268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University