View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3521_high_11 (Length: 285)
Name: NF3521_high_11
Description: NF3521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3521_high_11 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 218 - 285
Target Start/End: Complemental strand, 46247159 - 46247092
Alignment:
| Q |
218 |
taaaataatgcaaagttgtggttaattcatttaaatatatggtcaatttatttattttttgacaaaaa |
285 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46247159 |
taaaataatgcaaaattgtggttaattcatttgaatatatggtcaatttatttattttttgacaaaaa |
46247092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 251 - 285
Target Start/End: Complemental strand, 46247067 - 46247033
Alignment:
| Q |
251 |
aatatatggtcaatttatttattttttgacaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46247067 |
aatatatggtcaatttatttattttttgacaaaaa |
46247033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University