View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3521_high_14 (Length: 224)
Name: NF3521_high_14
Description: NF3521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3521_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 5e-40; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 13 - 138
Target Start/End: Complemental strand, 2111370 - 2111239
Alignment:
| Q |
13 |
agcagagaaagagaaaatggggagtaatgagaggttggtgagaa-ccattgtatctatgat-----ctatggtctcattggtttgttgctatggaatgct |
106 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
2111370 |
agcaaagaaagagaaaatggggagttatgagaggttggtgagaaaccattgtatctatgatatgatctatggtctcattggtttgttgctatggaaagct |
2111271 |
T |
 |
| Q |
107 |
agaagtggaaacttttgtgtttctgcatgaaa |
138 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |
|
|
| T |
2111270 |
agaagaggaaacttttgtgtatctgcatgaaa |
2111239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 56 - 138
Target Start/End: Complemental strand, 2129529 - 2129447
Alignment:
| Q |
56 |
accattgtatctatgatctatggtctcattggtttgttgctatggaatgctagaagtggaaacttttgtgtttctgcatgaaa |
138 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2129529 |
accattgtatctatgatctatggcctcattggtttgttgtgatgaaatgctagaagtggaaagttttgtgtttctgcatgaaa |
2129447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 144 - 201
Target Start/End: Complemental strand, 2111189 - 2111132
Alignment:
| Q |
144 |
aattctgctcatgcatattaatactttggtccaagagagcatgcgtgtaaaccaagta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2111189 |
aattctgctcatgcatattaatactttggtccaagagaccatgcgtgtaaaccaagta |
2111132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 130 - 187
Target Start/End: Complemental strand, 2129423 - 2129366
Alignment:
| Q |
130 |
tgcatgaaaagggaaattctgctcatgcatattaatactttggtccaagagagcatgc |
187 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2129423 |
tgcatgaaaagggaaattctgcccatgcatattaatactttggtccaagagaccatgc |
2129366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University