View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3521_high_8 (Length: 298)
Name: NF3521_high_8
Description: NF3521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3521_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 9 - 283
Target Start/End: Original strand, 27172081 - 27172355
Alignment:
| Q |
9 |
gaagaatattattttgtagaggtttaggtagtgaaggaaaggtttgatttgatgtttcaatgagataattagtatttggtggcatttgtgaactaagaat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27172081 |
gaagaatattattttgtagaggtttaggtagtgaaggaaaggtttgatttgttgtttcaatgagataattagtatttggtggcatttgtgaactaagaat |
27172180 |
T |
|
| Q |
109 |
gaaaatggaattggaacttttataatttgcgttgtttctcttaggatgagaagacgaaagtaaattgtgagtttgtggatctaagccttgagaaataagc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27172181 |
gaaaatggaattggaacttttataatttgagttgtttctcttaggatgagaagaagaaagtaaattgtgagtttgtggatctaagccttgagaaataagc |
27172280 |
T |
|
| Q |
209 |
ttctttttaatgcaagagttccaaaaattcttcacttcattatcagttctaccaggaaggtgctttgctatttgg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27172281 |
ttctttttaatgcaagagttccaaaaattcttcacttcattatcagttctaccaggaaggtgctttgctatttgg |
27172355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University