View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3523_high_24 (Length: 259)
Name: NF3523_high_24
Description: NF3523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3523_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 1134838 - 1135080
Alignment:
| Q |
1 |
atgaaaatcggcggcattggcgatgttaccagagcaaacatcgccgacaccgaggaatggatccaccttagacggttttacatcgttgtcgtcgattgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1134838 |
atgaaaatcggcggcattggcgatgttatcagagcaaacatcgccgacaccgaggaatggatccaccttagacggttttacatcgttgtcgtcgattgct |
1134937 |
T |
|
| Q |
101 |
gtttcgacggtaacgggccgcttggtgaaaagttcatgatcaaattctgctgtgatccatttgaggtcatcgaagctggagaatatggaggttgctggca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1134938 |
gtttcgacggtaacgggccgcttggtgaaaagttcatgatcaaattctgctgtgatccatttgaggtcatcgaagctggagaatatggaggttgctggca |
1135037 |
T |
|
| Q |
201 |
gaatggtgctccattttggttccattttgaaggagagaaaatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1135038 |
gaatggtgctccattttggttccattttgaaggagagaaaatg |
1135080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University