View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3523_high_29 (Length: 249)
Name: NF3523_high_29
Description: NF3523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3523_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 81 - 239
Target Start/End: Original strand, 39541098 - 39541256
Alignment:
| Q |
81 |
ctgtagagacgaaaatcttgtgacaacctaggtggaaaatctagttggttccaagttaataggatnnnnnnnnnnnnnnnnntatctaactgcacgggaa |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39541098 |
ctgtagagacgaaaatcttgtgacaacctaggtggaaaatctagttggttccaagttaataggattgtgtgttgtgttgtgttatctaactgcacgggaa |
39541197 |
T |
 |
| Q |
181 |
agtacaacaaagataaagtaacaaaacaaacaaacttgagtaactaactaacgcctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39541198 |
agtacaacaaagataaagtaacaaaacaaacaaacttgagtaactaactaacgcctttg |
39541256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University