View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3523_low_31 (Length: 242)
Name: NF3523_low_31
Description: NF3523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3523_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 38850152 - 38849945
Alignment:
| Q |
17 |
attaacaagtaccactacttggatccgtatcatgatgttaatgtttttaatgatttggcaataacatattcgcacatagtgaattaataaccgcggaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38850152 |
attaacaagtaccactacttggatccgtatcatgatgttaatgtttttaatgatttggcaataacatattcgcaga--gtgaattaataaccgcggaaga |
38850055 |
T |
 |
| Q |
117 |
caagaatttttagtcatggttttatcattaaaagcgataccacttacttgcttgcatccatatcctgatttgttggatatcactactgtcactgtttctt |
216 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38850054 |
caagaatttt-agtcatggttttatcattaaaagcgataccacttacttgcttgcatccatatcttgatttgttggatatcactactgtcactgtttctt |
38849956 |
T |
 |
| Q |
217 |
tgtacctgcat |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
38849955 |
tgtacctgcat |
38849945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 38866092 - 38866143
Alignment:
| Q |
104 |
taaccgcggaagacaagaatt-tttagtcatggttttatcattaaaagcgat |
154 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
38866092 |
taaccacggaagacaagaattatttagtcatggttttatcattaaaaacgat |
38866143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University