View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3523_low_32 (Length: 237)
Name: NF3523_low_32
Description: NF3523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3523_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 2 - 225
Target Start/End: Original strand, 8320795 - 8321018
Alignment:
| Q |
2 |
aatgacatggatagtcggatttggattcttagcaattcatacaatcatgcaaccgtagatagaatacttgattgagattgaatagtttatgtttaaactt |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8320795 |
aatgacatcgatagtcggatttggattcttagcaattcatacaatcatgcaatcgaagatagaatactagattgagattgaatagtttatgtttaaactt |
8320894 |
T |
 |
| Q |
102 |
ttttattttgaaatgaatattaagttaaaatattagccatccaattttgattcgacgatctagattgtgtgaaatgaatgattttgtaattgtagataat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8320895 |
ttttattttgaaatgaatattaagttaaaatattggccatttaattttgattcgacgatctagattatgtgaaatgaatgattttgtaattgtagataat |
8320994 |
T |
 |
| Q |
202 |
atgatttcaacaaatacttcatca |
225 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
8320995 |
ttaatttcaacaaatacttcatca |
8321018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University