View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3525_high_2 (Length: 384)
Name: NF3525_high_2
Description: NF3525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3525_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 366
Target Start/End: Original strand, 30242633 - 30242998
Alignment:
| Q |
1 |
caaaacctcttcatcctcatcctctgattcttcttcctggtattcatagtcgctgtcatcttcgacatcggaagagatcttgtatataggtaattgagtg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30242633 |
caaaacctcttcgtcctcatcctctgattcttcttcctggtattcatagtcgctgtcatcttcgacatcggaagagatcttgtatataggtaattgagtg |
30242732 |
T |
 |
| Q |
101 |
tcttcttcttcagaggtaggtagtttgttgcgaggtggatggttgtattcaaggattcgagatttgggtttggaaaagcttagacgggtaagggtttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30242733 |
tcttcttcttcagaggtaggtagtttgttgcgaggtggatggttgtattcaaggattcgagatttgggtttggaaaagcttagacgggtaagggtttttg |
30242832 |
T |
 |
| Q |
201 |
ctcttgagggatgtttaggcttctcttgataaggttcagtgtagtggtgagtttcagtgtccatagtagaaggtttagggttgggttgttggtcaaggaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30242833 |
ctcttgagggatgtttaggcttctcttgatgaggttcagtgtagtggtgagtttcagtgtccatagtagaaggtttagggttgggttgttggtcaaggaa |
30242932 |
T |
 |
| Q |
301 |
gagaacaacttgaggttcggattcagcagtgtccattttagttgtataatactgccgggatgtaag |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30242933 |
gagaacaacttgaggttcggattcagcagtgtccattttagttgtataatactaccgggatgtaag |
30242998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University