View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3526_high_41 (Length: 239)
Name: NF3526_high_41
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3526_high_41 |
 | |
|
| [»] scaffold0360 (1 HSPs) |
| | |
|
| [»] scaffold0340 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 5862283 - 5862081
Alignment:
| Q |
20 |
agtgtgtaccggcaattaactgtcgagaaattcaatatcgaaggtacttaactgccgaggaatatgaaaccggcaatagttaactgccgagggacattta |
119 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5862283 |
agtgtgtatcggcagttaactgtcgagaaattcaatatcgaaggtacttaactgccgaggaatatgaaaccggcaatagttaactgccgagggacattta |
5862184 |
T |
|
| Q |
120 |
gctcatttcgtggtgtgtttgctgactataattcacccttaagacgaataaatgagatgtctaaagttcgaatataagctcttgcatttacgatgcactc |
219 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5862183 |
gctcatttcgtggtgtgtttagtgactataattcacccttaagacgaataaatgagatgtctaaagttcgaatataagctcttgcatttacgatgcactc |
5862084 |
T |
|
| Q |
220 |
ttc |
222 |
Q |
| |
|
||| |
|
|
| T |
5862083 |
ttc |
5862081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0360
Description:
Target: scaffold0360; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 139
Target Start/End: Original strand, 12955 - 13059
Alignment:
| Q |
35 |
ttaactgtcgagaaattcaatatcgaaggtacttaactgccgaggaatatgaaaccggcaatagttaactgccgagggacatttagctcatttcgtggtg |
134 |
Q |
| |
|
||||||| | || ||||||| ||| | |||| ||||||| |||| |||| |||||||||| ||||||||| ||| |||||||||| |||||| |||||| |
|
|
| T |
12955 |
ttaactgccaaggaattcaacatcaacggtagttaactgtcgagtgatataaaaccggcaacagttaactgtcgatggacatttaggtcattttgtggtg |
13054 |
T |
|
| Q |
135 |
tgttt |
139 |
Q |
| |
|
||||| |
|
|
| T |
13055 |
tgttt |
13059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0340 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0340
Description:
Target: scaffold0340; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 111
Target Start/End: Complemental strand, 1249 - 1205
Alignment:
| Q |
67 |
ttaactgccgaggaatatgaaaccggcaatagttaactgccgagg |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||| | ||||||||||||| |
|
|
| T |
1249 |
ttaactgccgaggaatttgaaaccggcagcaattaactgccgagg |
1205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University