View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3526_high_42 (Length: 237)
Name: NF3526_high_42
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3526_high_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 91 - 222
Target Start/End: Original strand, 32513348 - 32513479
Alignment:
| Q |
91 |
ccaaggagttcaaatacctgaactgaaacaaagatgcaaatgaaatgaaatgataattaggagaatatacaagagacttacaattgtagagaatgattaa |
190 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32513348 |
ccaaggagttgcaatacctgaactgaaacaaagatgcaaatgaaatgaaatgataattaggaggatatacaagagacttacaattgtagagaatgattaa |
32513447 |
T |
 |
| Q |
191 |
tgatgtatagtttatggtaagacgtggtacat |
222 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
32513448 |
tgatggatagtttatggtaagacgtggtacat |
32513479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University