View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3526_low_11 (Length: 470)
Name: NF3526_low_11
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3526_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 1e-76; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 64 - 241
Target Start/End: Original strand, 7421168 - 7421346
Alignment:
| Q |
64 |
attgagatctctacttcaactgtctatccacaagacacaaatatcagttagcatgttttaatcaatgtgtctgtcagttaccaaaaataaggaaagctgt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7421168 |
attgagatctctacttcaactgtctatccacaagacacaaatatcagttagcatgttttaatcaatgtgtctgtcagttaccaaaaataaggaaagctgt |
7421267 |
T |
|
| Q |
164 |
cgtttccctcttcaccttcaatgtgcnnnnnnngt-aaccaaaccaatctcaagaacaaacctaaaccttgttacaccg |
241 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7421268 |
cgtttccctcttcaccttcaatgtgcaaaaaaagtaaaccaaaccaatctcaagaacaaaccaaaaccttgttacaccg |
7421346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 15 - 67
Target Start/End: Original strand, 7421091 - 7421143
Alignment:
| Q |
15 |
acatgtaactcttaccattcgatctccggtttggtttttaaaacattagattg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7421091 |
acatgtaactcttaccattcgatctccggtttggtttttaaaacattagattg |
7421143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 148 - 189
Target Start/End: Complemental strand, 13028267 - 13028226
Alignment:
| Q |
148 |
aaataaggaaagctgtcgtttccctcttcaccttcaatgtgc |
189 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
13028267 |
aaataaggaaagttgttgtttccctcttcaccttcaatgtgc |
13028226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 396
Target Start/End: Original strand, 7421490 - 7421520
Alignment:
| Q |
366 |
agaaaatggcttataatcccaaccttaacaa |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7421490 |
agaaaatggcttataatcccaaccttaacaa |
7421520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University