View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3526_low_20 (Length: 348)
Name: NF3526_low_20
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3526_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 264
Target Start/End: Original strand, 38234926 - 38235178
Alignment:
| Q |
10 |
atagggcttgagttgcgtatctcacatgagaaagttcttcacagtcacactagtcattatatgcacgttttcttcataatttattttgaaaattgttttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38234926 |
atagggcttgagttgcgtatctcacatgagaaagttcttcacagtcacactagtcattatatgcacgttttcttcataatttattttgaaaattgttttt |
38235025 |
T |
|
| Q |
110 |
ctctattttaaaattgttcatttcctatagttaattccggcatttttcagctagaattaactctcattctataatgagtaannnnnnnnnnngacaattt |
209 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
38235026 |
ctctattttaaaattgttcattttctatagttaattccgacatttttcagctagactaaactctcattctataatgagtaa-ttttttttttgacaattt |
38235124 |
T |
|
| Q |
210 |
attcttaattttgttgaagagtatcatattcaatatttaacttgcaattgagttc |
264 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38235125 |
attcttaattttgttgaagagtat-atattcaatatttaacttgcaattgagttc |
38235178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University