View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3526_low_29 (Length: 272)
Name: NF3526_low_29
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3526_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 15 - 265
Target Start/End: Complemental strand, 26998547 - 26998296
Alignment:
| Q |
15 |
attataaactaatttttgtccctattatctattttagatcccctattatgtgggcaagtataaaccatagttttactcacattcactaattgctcagcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
26998547 |
attataaactaatttttgtccctattatctattttagatcccctattatgtgggcaagtataaaccatagttttactcacattcactacttgctcaacat |
26998448 |
T |
 |
| Q |
115 |
tttt-atacctcaatctcattgtgataaatgcacttccattgtctatgttgaataatttatttttaaaaattaattagatcttaaactcgtgtgatttta |
213 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26998447 |
tttttatacctcaatctcatcgtgataaatgcacttccattgtctatgttgaataatttgtttttaaaaattaattagatcttaaactcgtgtgatttta |
26998348 |
T |
 |
| Q |
214 |
aaagttaaatattactttgggtgagcatgaggtggccgagttgcctatgtta |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26998347 |
aaagttaaatattactttgggtgagcatgagctggccgagttgcctatgtta |
26998296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University