View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3526_low_30 (Length: 272)
Name: NF3526_low_30
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3526_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 17 - 254
Target Start/End: Original strand, 35371928 - 35372163
Alignment:
| Q |
17 |
caaacactttttaaataaaaatatattcaagaatggaattttcatatatttttatttctgggtaagttattcctgggtataatttgcgtgtcaccaaaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
35371928 |
caaacactttttaaataaaaatatatccaggaatggaattttcatat--ttttattttcgggtaagttattcctgggtataatttgtgtgtcaccgaaac |
35372025 |
T |
 |
| Q |
117 |
aaactccctcatagtatttaatttcattggacaattgttttgacactattatttttaatcacacaaaaaatagtcatggatccgcctcttaagacaccga |
216 |
Q |
| |
|
|||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35372026 |
aaacgtccccatagtatttaatttaattggacaattgttttgacactattatttttaatcacacaaaaaatagtcatggatccgcctcttgagacaccga |
35372125 |
T |
 |
| Q |
217 |
gggaatattgaaaaggatgatcaaagtttgattcacgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35372126 |
gggaatattgaaaaggatgatcaaagtttgattcacgt |
35372163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University