View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3526_low_32 (Length: 253)
Name: NF3526_low_32
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3526_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 39000359 - 39000608
Alignment:
| Q |
1 |
aacaaatgagaaattttgatgtatgtttttgtaattttcgtatatttatggactaaatgacaaggactcacaaaaattactatttacacttctttctttg |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39000359 |
aacaaatgagaaatttcaatgtatgtttttgtaattttcgtatattcatggactaaatgacaagaactcacaaaaattactatttacacttctttctttc |
39000458 |
T |
 |
| Q |
101 |
gtgttttg-----ctttgcttgataatgcagcttccgtatttagtgcataatttcctccactcatagtattggtgttggaggacccacttgccactatct |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000459 |
gtgttttgctttgctttgcttgataatgcagcttccgtatttagtgcataatttcctccactcatagtattggtgttggaggacccacttgccactatct |
39000558 |
T |
 |
| Q |
196 |
tcattatcactcattccactcaatctttcaatagataccatccctatgct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39000559 |
tcattatcactcattccactcaatctttcaatagataccatccctatgct |
39000608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University