View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3526_low_34 (Length: 251)
Name: NF3526_low_34
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3526_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 52 - 246
Target Start/End: Complemental strand, 32512883 - 32512688
Alignment:
| Q |
52 |
tgtttgaatattgatatgcaggcttgttttagaatgggtccaaagaaatggtttaaaataataatcagaaggaagaaaaggaaagaagataaatctaacc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
32512883 |
tgtttgaatattgatatgcaggcttgttttagaatgggtccaaagaaatggtttaaaataataatcagaaggaagaaacggaaagaagataaatccaacc |
32512784 |
T |
 |
| Q |
152 |
aagaaaaggtttttacnnnnnnnnnnnnnntttcagtccttcaactt---taaaatttgcaaacatgatgagagtttggagagaatttctctgctcct |
246 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32512783 |
aagaaaaggtttttac--ctttctctctcttttcagtccttcaactttaataaaatttgcaaacatgatgagagtttggagagaatttctctgctcct |
32512688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 32512956 - 32512906
Alignment:
| Q |
6 |
aatggagtttatgattttctagacacatttcttcaagtattatagctgttt |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32512956 |
aatggagtttatgattttctagacacatttcttcaagtattatagctgttt |
32512906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University