View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3526_low_42 (Length: 237)

Name: NF3526_low_42
Description: NF3526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3526_low_42
NF3526_low_42
[»] chr2 (1 HSPs)
chr2 (91-222)||(32513348-32513479)


Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 91 - 222
Target Start/End: Original strand, 32513348 - 32513479
Alignment:
91 ccaaggagttcaaatacctgaactgaaacaaagatgcaaatgaaatgaaatgataattaggagaatatacaagagacttacaattgtagagaatgattaa 190  Q
    ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
32513348 ccaaggagttgcaatacctgaactgaaacaaagatgcaaatgaaatgaaatgataattaggaggatatacaagagacttacaattgtagagaatgattaa 32513447  T
191 tgatgtatagtttatggtaagacgtggtacat 222  Q
    ||||| ||||||||||||||||||||||||||    
32513448 tgatggatagtttatggtaagacgtggtacat 32513479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University