View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3527_low_10 (Length: 331)
Name: NF3527_low_10
Description: NF3527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3527_low_10 |
 | |
|
| [»] scaffold0361 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0361 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 62 - 101
Target Start/End: Original strand, 16336 - 16375
Alignment:
| Q |
62 |
ggagtttggatctgctccagttcttgtttcctccagtttt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16336 |
ggagtttggatctgctccagttcttgtttcctccagtttt |
16375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 19 - 50
Target Start/End: Original strand, 19694552 - 19694583
Alignment:
| Q |
19 |
tccattccattgcatgcaccccaaattggggg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19694552 |
tccattccattgcatgcaccccaaattggggg |
19694583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 63
Target Start/End: Complemental strand, 33450655 - 33450626
Alignment:
| Q |
34 |
gcaccccaaattgggggaatggaaaattgg |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33450655 |
gcaccccaaattgggggaatggaaaattgg |
33450626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 15581703 - 15581658
Alignment:
| Q |
19 |
tccattccattgcatgcaccccaaattg-ggggaatggaaaattgg |
63 |
Q |
| |
|
|||||||||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
15581703 |
tccattccattggatacaccccaaattggggggaatggaaaattgg |
15581658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University