View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3527_low_24 (Length: 235)
Name: NF3527_low_24
Description: NF3527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3527_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 2392117 - 2391906
Alignment:
| Q |
18 |
caccaatgataggaagtaggaacgatcgtaattcttgcaagtacagtttgctaagcttttcacttccttgttgtcccaaggatataaagctttagcttcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2392117 |
caccaatgataggaagtaggaacgatcgtaattcttgcaagtacagtttgctaagcttttcacttccttgttgtcccaaggatataaagctttagcttcc |
2392018 |
T |
|
| Q |
118 |
atagtttgagtttgtgaattggaatggttcacgcacccacttatctatagtgatcaatatctattatcctacttgcaagtgtatgtcccgttggtttttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2392017 |
atagtttgagtttgtgaattggaatggttcacgcacccacttatctatagtgatcaatatctattatcctacttgcaagtgtatgtcccgttggtttttt |
2391918 |
T |
|
| Q |
218 |
gtgtcaaatatc |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2391917 |
gtgtcaaatatc |
2391906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 229
Target Start/End: Original strand, 2364981 - 2365022
Alignment:
| Q |
188 |
acttgcaagtgtatgtcccgttggttttttgtgtcaaatatc |
229 |
Q |
| |
|
|||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
2364981 |
acttacaagtgtatgtctcattggttttttgtgtcaaatatc |
2365022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 126 - 170
Target Start/End: Original strand, 4250871 - 4250915
Alignment:
| Q |
126 |
agtttgtgaattggaatggttcacgcacccacttatctatagtga |
170 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
4250871 |
agtttgtgaattggaatggttcacgtactcacttatctatagtga |
4250915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 60 - 94
Target Start/End: Original strand, 4250798 - 4250832
Alignment:
| Q |
60 |
acagtttgctaagcttttcacttccttgttgtccc |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
4250798 |
acagtttgctaagcttttcacttccttgttgtccc |
4250832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University