View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3527_low_27 (Length: 210)

Name: NF3527_low_27
Description: NF3527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3527_low_27
NF3527_low_27
[»] chr2 (1 HSPs)
chr2 (16-193)||(6373317-6373494)


Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 193
Target Start/End: Original strand, 6373317 - 6373494
Alignment:
16 atatctttatggtgacatggatccgacttgtgtggcacatcgtctagagcgccgtccctaagatgatgcattgcattgcatgcacggaacaaaaagtaaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6373317 atatctttatggtgacatggatccgacttgtgtggcacatcgtctagagcgccgtccctaagatgatgcattgcattgcatgcacggaacaaaaagtaaa 6373416  T
116 ctccacgaaacttcaactaaaatgactttaaacatggtagtagtatttttgttctccccagcgatgcaaactcacatg 193  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||    
6373417 ctccacgaaacttcaactaaaatgactttaaacatgggagtagtatttttgttctccccaacgatgcaaattcacatg 6373494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University