View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3527_low_4 (Length: 405)
Name: NF3527_low_4
Description: NF3527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3527_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 9073338 - 9073068
Alignment:
| Q |
18 |
attttaagcaatttactagatttcttttgaagatttatgaacttaaaagatatatatctaatatatgtaggagcaagatagtggacttcaactagtgcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
9073338 |
attttaagcaatttactagatttcttttgaagatttatgaacttaaaagatatatatctaatatatgtaggagcaagacagtggacttcaattagtgcac |
9073239 |
T |
|
| Q |
118 |
ttgcttctagcatgtgctgaagcagtggcaaaaggtgaatacatgctagcaagaaggtacctacaccagctcaatagagtagtaacaccactaggtgact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073238 |
ttgcttctagcatgtgctgaagcagtggcaaaaggtgaatacatgctagcaagaaggtacctacaccagctcaatagagtagtaacaccactaggtgact |
9073139 |
T |
|
| Q |
218 |
ccatgcaacgagtagcttcatgtttcacagaatctctaagtgcaagacttgctgcaaccctaaccaccaag |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073138 |
ccatgcaacgagtagcttcatgtttcacagaatctctaagtgcaagacttgctgcaaccctaaccaccaag |
9073068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 347 - 386
Target Start/End: Complemental strand, 9073009 - 9072970
Alignment:
| Q |
347 |
gtttatctaccttcccatcaaaccctatggaagtcctcaa |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9073009 |
gtttatctaccttcccatcaaaccctatggaagtcctcaa |
9072970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University