View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3527_low_8 (Length: 356)
Name: NF3527_low_8
Description: NF3527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3527_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 343
Target Start/End: Original strand, 23447630 - 23447969
Alignment:
| Q |
1 |
tctttagcattattttgctactcaaacttgtagtttacatataaggattgttctttatgtaatggtttaaacttattggttgcatggtcattctctatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23447630 |
tctttagcattattttgctactcaaacttgtagtttacatataaggattgttctttatgtaatggtttaaacttattggttgcatggtcattatctatct |
23447729 |
T |
|
| Q |
101 |
atatgtactttaaagttttaaatttcataatacaaaatagat-nnnnnnnnnggtgacttgagcactatagtatatacggcaaaggatagagacaaagtc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
23447730 |
atatgtactttaaagttttaaatttcataatacaaaatagataaaaaaaaagggtgacttgagcac-----tatatacagcaaaggatagagacaaagtc |
23447824 |
T |
|
| Q |
200 |
atcaaacttaaacatgttcaagtgaaattcaagttacatgtcacatcattaccatttaacttgattaa-nnnnnnnnngcaattttaaaagcttaattga |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23447825 |
atcaaacttaaacatgttcaagtgaaattcaagttacatgtcacatcattaccatttaacttgattaattttttttttgcaattttaaaagcttaattga |
23447924 |
T |
|
| Q |
299 |
ttattttattnnnnnnnnntactgtttgttgctgggtaagtactg |
343 |
Q |
| |
|
|||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
23447925 |
ttattttactaaaaaaaaatactatttgttgctgggtaagtactg |
23447969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University