View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3528_low_3 (Length: 282)
Name: NF3528_low_3
Description: NF3528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3528_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 267
Target Start/End: Original strand, 44344337 - 44344585
Alignment:
| Q |
19 |
gttataggaaaagttgaaatgaaaaagagaagaaaataaggagaagagatgtatgttagtttttatacttacaagtgaaaatgaaatgatgagaagagaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344337 |
gttataggaaaagttgaaatgaaaaagagaagaaactaaggagaagagatgtaggttagtttttttacttacaagtgaaaatgaaatgatgagaagagaa |
44344436 |
T |
|
| Q |
119 |
gaggaagaattgttggttcnnnnnnnngaaaggcgttggagtaggagtttgtgatgatccaaaatttggtgaagaaaagataaaccattggaacgtgtaa |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44344437 |
gaggaagaattgttggttcaaaaaaaagaaaggcgttggagtaggagtttgtgatgatccaaaatttggtgaacaaaagataaaccattggaacgtgtaa |
44344536 |
T |
|
| Q |
219 |
tgtagcatgcacaacacttgtttctcttccatgtcgtcaatgacctatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44344537 |
tgtagcatgcacaacacttgtttctcttccatgtcgtcaatgacctatg |
44344585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University