View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3528_low_4 (Length: 250)

Name: NF3528_low_4
Description: NF3528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3528_low_4
NF3528_low_4
[»] scaffold0011 (1 HSPs)
scaffold0011 (7-250)||(240553-240796)


Alignment Details
Target: scaffold0011 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 240796 - 240553
Alignment:
7 tcgaagaatatggggtgttggatgatttatttcacatgggatagctgacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattg 106  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
240796 tcgaaaaatatggggtgttggatgatttatttcacatgggatagctgacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattg 240697  T
107 caatcttccgagtctcagttttggtaaaattttagcaccttagttaaatagagacataaaatagaacaatacagcaaattccatgtgtgaagccgataag 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
240696 caatcttccgagtctcagttttggtaaaattttagcaccttagttaaatagagacataaaatagaacaatacagcaaattccatgtgtgaagccgataag 240597  T
207 agtgtaacacctaaatttgaaagcaaagtaaaatggatttaatt 250  Q
    |||||||||||||||| |||||||||||||||||||||||||||    
240596 agtgtaacacctaaatgtgaaagcaaagtaaaatggatttaatt 240553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University