View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3528_low_6 (Length: 241)
Name: NF3528_low_6
Description: NF3528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3528_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 33 - 201
Target Start/End: Original strand, 1128275 - 1128443
Alignment:
| Q |
33 |
atcttaatgacatgtaccgatgacgaaaacaaaaacaattctcaggacagtgaaacaccacatcaattcaataaatatcaaagaaagctatataccttca |
132 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||| ||| ||||||||||||| |
|
|
| T |
1128275 |
atcttaatgacatgtaccgatgaagaaaacaaaaacaattctcaggacagtgaaacaccacgtcagttcaattaatatcaaaaaaaactatataccttca |
1128374 |
T |
|
| Q |
133 |
ttctcattacaacagcaccctaaaggcaaaaccacaatcaagtctattcatcaagttctactccccctt |
201 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1128375 |
ttctcattacaacagcaccctaaaagcaaaaccacaatcaagtctattcatcaagttctactccccctt |
1128443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 40 - 104
Target Start/End: Complemental strand, 242379 - 242315
Alignment:
| Q |
40 |
tgacatgtaccgatgacgaaaacaaaaacaattctcaggacagtgaaacaccacatcaattcaat |
104 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
242379 |
tgacatgtactgatgaagaaaacaaaaacaattctcaggacagtgaaacaccacattagttcaat |
242315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 1127330 - 1127363
Alignment:
| Q |
8 |
tgagatgaagccaaacttgacaacaatcttaatg |
41 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
1127330 |
tgagttgaagccaaacttgacaacaatcttaatg |
1127363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University