View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3528_low_7 (Length: 201)
Name: NF3528_low_7
Description: NF3528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3528_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 4 - 187
Target Start/End: Complemental strand, 39360450 - 39360267
Alignment:
| Q |
4 |
tcaagtcctagaattcactacagattcctctgtgtcctttttcctcaatttgagtaccttggaccaaaagccatctttctttcttcctctacctccacca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39360450 |
tcaagtcctagaattcactacagattcctctgtatcctttttcctcaatttgagtaccttggaccaaaagccatctttctttcttcctctacctccacca |
39360351 |
T |
|
| Q |
104 |
acatccctctccctgactcggttcctcggaacaacggcaagtgacttgctcttcttcaagttcaacgcatgattaaagcttatc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39360350 |
acatccctctccctgactcggttcctcgaaacaacggcaagtgacttgctcttcttcaagttcaacgcatgattaaagcttatc |
39360267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University