View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3528_low_7 (Length: 201)

Name: NF3528_low_7
Description: NF3528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3528_low_7
NF3528_low_7
[»] chr3 (1 HSPs)
chr3 (4-187)||(39360267-39360450)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 4 - 187
Target Start/End: Complemental strand, 39360450 - 39360267
Alignment:
4 tcaagtcctagaattcactacagattcctctgtgtcctttttcctcaatttgagtaccttggaccaaaagccatctttctttcttcctctacctccacca 103  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39360450 tcaagtcctagaattcactacagattcctctgtatcctttttcctcaatttgagtaccttggaccaaaagccatctttctttcttcctctacctccacca 39360351  T
104 acatccctctccctgactcggttcctcggaacaacggcaagtgacttgctcttcttcaagttcaacgcatgattaaagcttatc 187  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39360350 acatccctctccctgactcggttcctcgaaacaacggcaagtgacttgctcttcttcaagttcaacgcatgattaaagcttatc 39360267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University