View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3529_high_7 (Length: 382)

Name: NF3529_high_7
Description: NF3529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3529_high_7
NF3529_high_7
[»] chr8 (1 HSPs)
chr8 (9-107)||(33764102-33764199)


Alignment Details
Target: chr8 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 9 - 107
Target Start/End: Complemental strand, 33764199 - 33764102
Alignment:
9 gagatgaaacgtttttgaaaaataacaaaaatattgtttcgatgttcattgtttctnnnnnnnnntaatgcatataaattgcacaactcaagaatttag 107  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |         ||||||||||||||||||||||||||||||||||    
33764199 gagatgaaacgtttttgcaaaataacaaaaatattgtttcgatgttcattgttt-tttaaaaaaataatgcatataaattgcacaactcaagaatttag 33764102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University