View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3529_high_9 (Length: 348)
Name: NF3529_high_9
Description: NF3529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3529_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 217 - 344
Target Start/End: Original strand, 38015464 - 38015591
Alignment:
| Q |
217 |
aaatgttcacatattatatattttcctttattaatgacagaaacaaacagaagccaagcacatacctttttcttcgtaatgaggtaatcaaactcgagca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
38015464 |
aaatgttcacatattatatattttcctttattaatgacagaaacaaacagaagacaagcacatacctttttcttcgtaatgaggtaatcaaactccatca |
38015563 |
T |
 |
| Q |
317 |
atgtcaggctaaccagttcatctcactc |
344 |
Q |
| |
|
||||||||||||| | ||||||| |||| |
|
|
| T |
38015564 |
atgtcaggctaactaattcatctaactc |
38015591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 38015339 - 38015429
Alignment:
| Q |
1 |
agaagtgtctttcataggacactttgcagaagaaataatgttccacgcttcgacccaatattaatgaagtgcaattgtttcatgagcacaa |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38015339 |
agaagtgtctttcataggacactttgcagaagaactaatgtttcacacttcgacccaatattaatgaagtgcaattctttcatgagcacaa |
38015429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University