View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3529_low_18 (Length: 227)
Name: NF3529_low_18
Description: NF3529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3529_low_18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 2862007 - 2861789
Alignment:
| Q |
7 |
gctcaagcacatattgtcgactagtggaagagtaataacgaattacaagatccaa-------cagttgaaagtagtttacttatgcaagaagnnnnnnnn |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2862007 |
gctcaagcacatattgtcaactagtggaagagtaataacgaattacaagatccaagatccagcagttgaaagtagtttacttatgcaagaagtttttcaa |
2861908 |
T |
|
| Q |
100 |
nnnnnnnnnnnnnaacaagtatatgatgtcaaaacagaaagtttgacaaaagaacgctgcttataataacatttgtaaaagtagtagcatcttcnnnnnn |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2861907 |
ttttt--------aacaagtatatgatgtcaaaacagaaagtttgacaaaagaacgctgcttataataacatttgtaaaagtagtcgcatcttc-ttttt |
2861817 |
T |
|
| Q |
200 |
nncccatgtgggctacttagtgtgtgtt |
227 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
2861816 |
ttcccatgtgggctactcagtgtgtgtt |
2861789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University