View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3529_low_7 (Length: 382)
Name: NF3529_low_7
Description: NF3529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3529_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 9 - 107
Target Start/End: Complemental strand, 33764199 - 33764102
Alignment:
| Q |
9 |
gagatgaaacgtttttgaaaaataacaaaaatattgtttcgatgttcattgtttctnnnnnnnnntaatgcatataaattgcacaactcaagaatttag |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
33764199 |
gagatgaaacgtttttgcaaaataacaaaaatattgtttcgatgttcattgttt-tttaaaaaaataatgcatataaattgcacaactcaagaatttag |
33764102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University