View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3530_low_6 (Length: 253)
Name: NF3530_low_6
Description: NF3530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3530_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 35508723 - 35508529
Alignment:
| Q |
18 |
gattcatgaggatggatgtctatatcatctttaatttgattgatattgataattcaaactgaaagcgaaacgtgtgcttctagaattttaggtgataaat |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35508723 |
gattcacgaggatggatgtctatatcatctttaatttgattgatattgataattcaaactgaaagcgatacgtgtgcttctagaattttaggtgataaat |
35508624 |
T |
 |
| Q |
118 |
attcgtttgttgctattacatgtgactgcaagtattcaaatgcatgttggcctctaaatatattttaatctactagtagtc-tttatttttgttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
35508623 |
attcgtttgttgctattacatgtgactgcaagtattcaaatgcatgttggcctctaaatatatttttatctactagtagtcttttatttttgttg |
35508529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University