View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3532_high_9 (Length: 242)
Name: NF3532_high_9
Description: NF3532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3532_high_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 44 - 242
Target Start/End: Original strand, 33658654 - 33658853
Alignment:
| Q |
44 |
tacaaacatacaaacactctt-----aaccgtgtcttcgtatcgtacacatgtcagtgtccaacatttatgcgacactcatacggcatacgtccgataac |
138 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
33658654 |
tacaaacatacaaacactctttgattagccgtgtctttgtatcgtacacatgtcagtgtccaacatttgtgcgacactcatacaacatacgtccgataac |
33658753 |
T |
 |
| Q |
139 |
tcaaaaagaaagggtcctacaaaattatttttattatattcttacacaattttaacactctttagacacatgatcatagacttattagacataatatttt |
238 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
33658754 |
tca----gaaagtgtcctacaaaattatttttattatattcttacacaattttaacactctttaaacacatgatcatagactttttagacataatatttt |
33658849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University