View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3532_low_7 (Length: 257)
Name: NF3532_low_7
Description: NF3532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3532_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 51078775 - 51078993
Alignment:
| Q |
10 |
cagaacctgtgaccaacatgtagccaaatgaacattgtttttgcccgcaggcatcagaagatgtattgcttctcttaagcatagcccattactccctcac |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51078775 |
cagaaactgtgaccaacatgtagccaaatgaacattgtttttgcccacaggcatcagaagatgtattgcttctcttaagcatagcccattactccctcaa |
51078874 |
T |
|
| Q |
110 |
cagcatttctgcaacagaacgaatgcaattaggcaactaagttcaaagggggt--ggataacaaataacttgacatcacactgctacagcaaacattcaa |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
51078875 |
cagcatttctgcaacagaacaaatgcaattaggcaactaagttcaaagggggtggggataacaaat---------------tgctacagcaaacattcaa |
51078959 |
T |
|
| Q |
208 |
actgcccccaccccaaaatattgcaatgcttttg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
51078960 |
actgcccccaccccaaaatattgcaatgcttttg |
51078993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University