View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3534_high_7 (Length: 248)
Name: NF3534_high_7
Description: NF3534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3534_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 41103240 - 41102999
Alignment:
| Q |
1 |
ctcacaatcacttgactaaagaatgaaatgcaaactgctacgaattacaagtctcacaaaaatgccacttcttgaaaaaatttaagcctgcac----aat |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41103240 |
ctcacaatcacttgactaaagaatgaaatgcaaactgctacgaattacaagtctcacaaaaatgccacttcttgaaaaaatttaagcctgcacgcacaat |
41103141 |
T |
|
| Q |
97 |
ccaattttaagaccaaaccccatcagctccggaaagaacatggaagctcggtgcttattattcccttctgccactatgtcaaaaacagaagctgcattct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41103140 |
ccaattttaagaccaaaccccatcagctccggattgaacatggaagctcggtgcttattattcccttctgccactgtgtcaaaaacagaagctgcattct |
41103041 |
T |
|
| Q |
197 |
gacagcgcagcagtgtcccctgcagaatgcaaaacacttcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41103040 |
gacagcgcagcagtgtcccctgcagaatgcaaaacacttcat |
41102999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 41080837 - 41080600
Alignment:
| Q |
1 |
ctcacaatcacttgactaaagaatgaaatgcaaactgctacgaattacaagtctcacaaaaatgccacttcttgaaaaaatttaagcctgcacaatccaa |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||| |||||||||| |||| |||||||| |||||||||||||||||||| || ||||| ||| |
|
|
| T |
41080837 |
ctcacaatcaattgactaaagaatgaaatgcaaacttctatgaattacaagcctcataaaaatgctgcttcttgaaaaaatttaagcatgtacaatacaa |
41080738 |
T |
|
| Q |
101 |
ttttaagaccaaaccccatcagctccggaaagaacatggaagctcggtgcttattattcccttctgccactatgtcaaaaacagaagctgcattctgaca |
200 |
Q |
| |
|
| ||||||| |||| |||| ||| || | ||||| | |||||||| ||||||| ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
41080737 |
atctaagaccggtccccttcagttccagattcagaatggaggatcggtgctcattattctcttctgctactgcatcaaaaacagaagctgcattctgacg |
41080638 |
T |
|
| Q |
201 |
gcgcagcagtgtcccctgcagaatgcaaaacacttcat |
238 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||| |
|
|
| T |
41080637 |
ctgcagcattgtcccctgcagaatgcaaaacacgtcat |
41080600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 153 - 237
Target Start/End: Complemental strand, 1216456 - 1216372
Alignment:
| Q |
153 |
attattcccttctgccactatgtcaaaaacagaagctgcattctgacagcgcagcagtgtcccctgcagaatgcaaaacacttca |
237 |
Q |
| |
|
||||||| ||||||| ||| |||||||| ||||||| |||||||||| ||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
1216456 |
attattctcttctgctactgcgtcaaaaatagaagctccattctgacaccgcagtagtgtcccctgcaaaatgcaaaacacttca |
1216372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 1216606 - 1216545
Alignment:
| Q |
1 |
ctcacaatcacttgactaaagaatgaaatgcaaactgctacgaattacaagtctcacaaaaa |
62 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
1216606 |
ctcacaatcacttgagtaaagaattaaatgcaaattgctacgaattacaatcctcacaaaaa |
1216545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 70
Target Start/End: Complemental strand, 41088809 - 41088743
Alignment:
| Q |
4 |
acaatcacttgactaaagaatgaaatgcaaactgctacgaattacaagtctcacaaaaatgccactt |
70 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| |||| ||| |||||||| |||| |
|
|
| T |
41088809 |
acaatcacttgataaaagaatgaaatacaaactgctacgaattgcaagcctctaaaaaatgctactt |
41088743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University