View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3535_high_12 (Length: 238)
Name: NF3535_high_12
Description: NF3535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3535_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 5262658 - 5262880
Alignment:
| Q |
1 |
tttcaaatataaaaaataaggtgatgctgcactcctttgatttattgnnnnnnnnattttatttgtaccttttgttgttattactttcctta----ccat |
96 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||| |||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
5262658 |
tttcaaatataaaaaataaggtgaggtcgcactcctttgatttattgtttttt---ttttatttataccttttgttgttgttactttccttacttaccat |
5262754 |
T |
 |
| Q |
97 |
tctctcttctcacgtacattgtagaagaaaagataaggagataatgtgggatgtaagaataatttgtgaatgatgggtggatatttatagg-gggatttg |
195 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5262755 |
tctctcttctcacgcacattgtagaagaaaagataaggagagaatgtgggatgtaaagataatttgtgaatgatgggtggatatttataggagggatttg |
5262854 |
T |
 |
| Q |
196 |
tgcaggatgttgcataaagtgtaaca |
221 |
Q |
| |
|
|| |||| ||||||| |||||||||| |
|
|
| T |
5262855 |
tggaggaagttgcattaagtgtaaca |
5262880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 191
Target Start/End: Original strand, 26203772 - 26203850
Alignment:
| Q |
112 |
acattgtagaagaaaagataaggagataatgtgggatgtaagaataatttgtgaatgatgggtggatatttataggggga |
191 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||| |||| || | |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
26203772 |
acattgtagaagaaaagagaaggatagaatgtgagatggaatgagaatttgtgaa-gatgggtggatatttattggggga |
26203850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University