View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3535_high_9 (Length: 329)
Name: NF3535_high_9
Description: NF3535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3535_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 16 - 145
Target Start/End: Original strand, 21962316 - 21962444
Alignment:
| Q |
16 |
agcagtaaaaacaatttttggaccaaaagaagactactaaaattttaaccataattgttttgttgtaattttactgtgacttgttgtccttatgaatctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21962316 |
agcagtaaaaacaatttttggaccaaaagac-agtactaaaattttaaccataattgttttgttgtaattttactgtgacttgttgtccttatgaatctt |
21962414 |
T |
|
| Q |
116 |
gttcccatagctggctagttttaactgtaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21962415 |
gttcccatagctggctagttttaactgtaa |
21962444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 202 - 315
Target Start/End: Original strand, 21962511 - 21962624
Alignment:
| Q |
202 |
gagtttgtcaatcctttttgttcatttttggcctctagttattggtggctgctgtttctcacgtaatgtttcatatgctgataagatgatgataaagcca |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21962511 |
gagtttgtcaatcctttttgttcatttttggcctctagttattggtggctgctgtttctcacgtaatgtttcatatgctgataagatgatgataaagcca |
21962610 |
T |
|
| Q |
302 |
attgtgtggaaaat |
315 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21962611 |
attgtgtggaaaat |
21962624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University