View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3535_low_12 (Length: 317)
Name: NF3535_low_12
Description: NF3535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3535_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 18814528 - 18814295
Alignment:
| Q |
18 |
agttttaacaacaatagcttcagtttctaggtcttgattccggcggtggtcaggagcgaagcggtgataatcagcggcggcgagaaagggaggtttcatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18814528 |
agttttaacaacaatagcttcagtttctaggtcttgattccggcggtggtcaggagcgaagcggtgataatcagcggcggcgagaaagggaggtttcatg |
18814429 |
T |
|
| Q |
118 |
gaggagaaagggacttgacgttgctgcatgatctggtccggcgcggcggtggcgggaggagttcgggtgcccgacatccacctgccggcgatggaaggaa |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18814428 |
gaggagaaagggagttgacgttgctgcatgatctggtccggcgcggcggtggcgggaggagttcgggtgcccgacatccacctgccggcgatggaaggaa |
18814329 |
T |
|
| Q |
218 |
atgggagggaaaaggaagagagatctatgtgttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
18814328 |
atgggagggaaaaggaagagagatctatgtgttt |
18814295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University