View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3535_low_13 (Length: 302)
Name: NF3535_low_13
Description: NF3535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3535_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 299
Target Start/End: Original strand, 3491989 - 3492270
Alignment:
| Q |
18 |
ttaggagtttgaatggtgttgtttccgagtcgaatgttgattcgtctcgtccttcaccgattgtgatggaacaatgtcaggagggtatgtcttgtttgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3491989 |
ttaggagtttgaatggtgttgtttccgagtcgaatgttgattcgtctcgtccttcaccgattgtgatggaacaatgtcaggagggtatgtcttgtttgta |
3492088 |
T |
 |
| Q |
118 |
ttacttgcttcagaagtttcctttgaaatttagttctggtggcgaaaatggtgttggagttgatggtttctcgagtgtgatggagggggttgtgagtgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3492089 |
ttacttgcttcagaagtttcctttgaaatttagttctggtggcgaaaatggtgttggagttgatggtttctcgagtgtgatggagggggttgtgagtgtt |
3492188 |
T |
 |
| Q |
218 |
gttttgaatttgatgggctctgatgctttttctagggattgttttgttgctgccggtgttgctctctgtgctcctcctcaag |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
3492189 |
gttttgaatttgatgggctctgatgctttttctagggattgttttgttgctgccggtgttgctctttgtgctgctcttcaag |
3492270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University