View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3535_low_14 (Length: 248)
Name: NF3535_low_14
Description: NF3535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3535_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 136 - 241
Target Start/End: Original strand, 9706500 - 9706606
Alignment:
| Q |
136 |
tgatgagagtaatcttctactctacttgt-gctgttgttcctttttcttcattttcttccaattgggagcttcaacgtgctttgtgtgttttttgtgtgc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9706500 |
tgatgagagtaatcttctactctacttgttgttgttgttcctttttcttcattttcttccaattggtagcttcaacgtgctttgtgtgttttttgtgtgc |
9706599 |
T |
 |
| Q |
235 |
gtctgtg |
241 |
Q |
| |
|
|| |||| |
|
|
| T |
9706600 |
gtgtgtg |
9706606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 9706366 - 9706441
Alignment:
| Q |
1 |
ctgacttctgatgatgttgatgaagctgatgatagtgttccgttgaaatcttcttctcttccattcacatttccca |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9706366 |
ctgacttctgatgatgttgatgaagctgatgatagtgttccattgaaatcttcttctcttccattcacatttccca |
9706441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University