View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3535_low_14 (Length: 248)

Name: NF3535_low_14
Description: NF3535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3535_low_14
NF3535_low_14
[»] chr2 (2 HSPs)
chr2 (136-241)||(9706500-9706606)
chr2 (1-76)||(9706366-9706441)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 136 - 241
Target Start/End: Original strand, 9706500 - 9706606
Alignment:
136 tgatgagagtaatcttctactctacttgt-gctgttgttcctttttcttcattttcttccaattgggagcttcaacgtgctttgtgtgttttttgtgtgc 234  Q
    ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
9706500 tgatgagagtaatcttctactctacttgttgttgttgttcctttttcttcattttcttccaattggtagcttcaacgtgctttgtgtgttttttgtgtgc 9706599  T
235 gtctgtg 241  Q
    || ||||    
9706600 gtgtgtg 9706606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 9706366 - 9706441
Alignment:
1 ctgacttctgatgatgttgatgaagctgatgatagtgttccgttgaaatcttcttctcttccattcacatttccca 76  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
9706366 ctgacttctgatgatgttgatgaagctgatgatagtgttccattgaaatcttcttctcttccattcacatttccca 9706441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University