View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3535_low_17 (Length: 231)
Name: NF3535_low_17
Description: NF3535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3535_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 53; Significance: 1e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 38084236 - 38084180
Alignment:
| Q |
104 |
ttagaacataaattcattattattgtgttggagttttatgcccaaagtttgaatcaa |
160 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38084236 |
ttagaacataaattcattattattgtgttcgagttttatgcccaaagtttgaatcaa |
38084180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 38084327 - 38084279
Alignment:
| Q |
13 |
aatatgcacaatttttcaaatgtataatcaaaatactaatatatattac |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38084327 |
aatatgcacaatttttcaaatgtataatcaaaatactaatatatattac |
38084279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 171 - 213
Target Start/End: Complemental strand, 38082655 - 38082613
Alignment:
| Q |
171 |
ttatgacactttcgaattgtgagacatgtgttgcggtagaaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38082655 |
ttatgacactttcgaattgtgagacatgtgttgcggtagaaca |
38082613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University