View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3535_low_6 (Length: 463)
Name: NF3535_low_6
Description: NF3535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3535_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 435; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 16 - 462
Target Start/End: Complemental strand, 5396233 - 5395787
Alignment:
| Q |
16 |
ttaggaactcgtcgaccgtggaaaaccatgtttgatatccggtcactcggcatccccactggtgtaccggaagcaatttcacgtgttcgtgtcaacatct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396233 |
ttaggaactcgtcgaccgtggaaaaccatgttcgatatccggtcactcggcatccccactggtgtaccggaagcaatttcacgtgttcgtgtcaacatct |
5396134 |
T |
 |
| Q |
116 |
catacttccgcatgaactacactatggtgatgcttttgattttgtttctgagccttttatggcatccttactcactcattgttttcgttatcctaatggc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396133 |
catacttccgcatgaactacactatggtgatgcttttgattttgtttctgagccttttatggcatccttactcactcattgttttcgttatcctaatggc |
5396034 |
T |
 |
| Q |
216 |
ggcatggttgttcttctacttcctccgtgatcagccggtgattttatggggtcggcttgttgatgatcgaattgtggttgttctcatggcgtttgttacg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396033 |
ggcatggttgttcttctacttcctccgtgatcagccggtgattttatggggtcggcttgttgatgatcgaattgtggttgttctcatggcgtttgttacg |
5395934 |
T |
 |
| Q |
316 |
gtggctttgttgcttcttacgcaagctactgttaatattgttgttgcggttagtgttgccactgtggttgtggtggcacatggtgtgtttaggaagacag |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395933 |
gtggctttgttgcttcttacgcaagctactgttaatattgttgttgcggttagtgttgccactgtggttgtggtggcacatggtgtgtttaggaagacag |
5395834 |
T |
 |
| Q |
416 |
aggatttgttctttgaggaagaagaagaagtcattgtctctgctgct |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
5395833 |
aggatttgttctttgaggaagaagaagaagtcattgtttctgttgct |
5395787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University