View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3536_high_26 (Length: 249)
Name: NF3536_high_26
Description: NF3536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3536_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 239
Target Start/End: Original strand, 26553334 - 26553556
Alignment:
| Q |
7 |
gcacgttggaaaaacattcagtacaagaatagaaacatttagaaatcagaatacacacatgcgcccatagagacacacaacactagtcagacaaaggtaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||| ||||||| ||| ||||||| |
|
|
| T |
26553334 |
gcacgttggaaaaacattcagtacaagaatagaaacatt-------cagaatacacacatgcgcgcatacagacacacaaaactagtcggaccaaggtaa |
26553426 |
T |
 |
| Q |
107 |
agtacaatacaaagggaaattagttacacatattgtcaaggtaatgtacaatacaaaaaagagaatgacaagatattgcatcaaatgacttgaatctata |
206 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26553427 |
agtacagtg-aaagggaaattagttacacat--tgtcaaggtaatgtacaattcaaaaaagagaatgacaagatattgcatcaaatgacttgaatctaca |
26553523 |
T |
 |
| Q |
207 |
agccttcaatgatcaaccttgttcttattccta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26553524 |
agccttcaatgatcaaccttgttcttattccta |
26553556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University